Christian Churches of God

No. 212A

 

 

Sons of Shem:

Part I

 

(Edition 1.1 20060224-20060225-20070416)

 

The birthright was passed to Shem, the youngest son of Noah, as priest of God in the order of Melchisedek. The descendants of Shem carried the priesthood down to Abraham and on into the lines of the descendants of Abraham. Shem produced a number of children and from them sprung a number of important nations of the world. The sons of Shem intermingled with the sons of Ham and Japheth and God’s promises to the world would be fulfilled in that mixing of nations.

 

 

Christian Churches of God

PO Box 369,  WODEN  ACT 2606,  AUSTRALIA

 

Email: secretary@ccg.org

 

(Copyright ã  2007 Wade Cox)

 

This paper may be freely copied and distributed provided it is copied in total with no alterations or deletions. The publisher’s name and address and the copyright notice must be included.  No charge may be levied on recipients of distributed copies.  Brief quotations may be embodied in critical articles and reviews without breaching copyright.

 

This paper is available from the World Wide Web page:
http://www.logon.org and http://www.ccg.org

 

 


 

 

 Sons of Shem: Part I


Preface

The Conversion of the Sons of Abraham

 

God established a covenant with Abraham and said He would make him the father of many nations. Through his offspring, who we call the Patriarchs, a number of nations were commenced and they were given birthright promises and were made part of an ongoing covenant between God and Abraham that they were expected to continue and fulfil.

 

In this series we will deal with the identities and ultimate destiny of these nations and their influence on the rest of the world.

 

Over the next time-cycle of 19 years and the final sequence of the Wars of the End arriving at the Jubilee of 2027, we will see these nations brought to repentance and conversion on a systematic and progressive basis.

 

Part I (No. 212A) deals with the Sons of Shem and their locations.

 

Part II (No. 212B) deals with the sons of Lot and also those of Esau and their identity, destiny and conversion.

 

Part III (No. 212C) deals with Ishmael and its destiny and conversion and place in the Kingdom of God.

 

Part IV (No. 212D) deals with the sons of Keturah and their identity, destiny and conversion.

 

Part V (No. 212E) will deal with the destiny of Judah and its conversion in the Last Days.

 

Part VI (No. 212F) will deal with Israel and its crisis and repentance.

 

Part VII (No. 212G) will be an Appendix for tables and charts

 

These six parts will explain what is required of the sons of Abraham and their place in the restoration of the world to the Laws of God.

 

The details of the covenant God made with Abraham and the legacy and priesthood established with him through Shem is also explained in the site www.abrahams-legacy.org

 

Introduction

 

The purpose of this paper is to expand on the work on the Genetic Origin of the Nations (No. 265) and deal with the sons of Shem and then lead in to the sons of Arphaxad and the descendants of Abraham, and their place in history and prophecy and their current identities.

 

The sons of Shem are Elam and Asshur, Arphaxad, Lud and Aram.

 

We know for certain that the Elamites became the Persians, the sons of Asshur became the Assyrians, the sons of Arphaxad became the Hebrews, and Aram became the Syrians and the source of the name of the Aramaic language. They also later went north into Armenia.

 

From the modern DNA sampling of the Assyrian project, the modern Assyrians are L, G, J and some R1b1, but it seems that the R1b1 tested are English on the paternal side and Assyrian on the maternal side. Thus, northern Aram (in the area of Armenia and Georgia) and Asshur developed the G Haplogroup, which is where it is found in greatest percentages.

 

Josephus gives us a clear indication of the sons of Aram when he says that of the four sons of Aram, Uz founded Trachonitis and Damascus, which is the country between Palestine and Ceolesyria, Ul founded Armenia and Gather the Bactrians, and Mesa the Mesaneans now called Charax Spasini. From this record the Semitic G Haplogroup would appear to come from Aram and Asshur. Josephus records that Abraham first settled with an army in Damascus (ibid., Whiston tr., p. 32).

 

Josephus says that Joktan of the Hebrews had thirteen sons:  Elmodad, Saleph, Asermoth, Jera, Adoram, Aizel, Decla, Ebal, Abimael, Sabeus, Ophir, Eulat, and Jobab. He says that these people inhabited Asia from the Indian River, Cophen, and the lands surrounding it. This is modern Kabul and the valley of its river. The land further towards the Indus is Bactria. Thus, if that is the fact of the matter they seemingly moved through the Arabian Peninsular and most went on to India. The result could be the composite groups of Joktan in what is Afghanistan, Gather in Bactria and then Lud in the Punjab. The Semitic Haplogroup H in India would then be derived from a mutation that occurred among the Hebrews of Joktan and the Semites of Lud. The golden wedge of Ophir refers to the lands of one of the sons of Joktan who settled in Afghanistan or India, and thus the area of Ophir may be from the Hindu Cush into India or perhaps, even more likely, Sri Lanka (Ceylon) (see also below).

Afghan and other Pashtun

 

The Wikipedia article on Pashtuns says they would appear to be primarily of Iranian origin, but have similarities with Persians, Kurds, Tajiks and Baluchis.

 

Pashto-speaking Pashtuns (or Pukhtuns, depending on dialect) and are found in southern and eastern Afghanistan and western Pakistan. These Pashtuns also became intermingled with others groups, such as the Ghilzai (who possibly mingled with Turkic tribes), the Durrani (who interacted with the Tajiks), and Pashtun tribes north of Peshawar (who mingled with Dardic groups).

 

The article went on to say that from the first to the fifth century BCE huge migrations of peoples from Aryans, Persians, Sakas, Scythians, Kushans, Huns, and Greeks moved into the regions where the Pashtuns lived. Later invaders were Muslim Arabs, Central Asian Turkic tribes and Mongols.

 

The anthropological evidence that the Pashto-speaking Pashtuns are an Indo-European  Caucasoid people, who are related to other Iranian groups and to speakers of the Kalasha and Nuristanis languages, is by no means conclusive. So far the testing has not shown any substantial connection between the Pashtun population sampled to the genetic markers found amongst most Greeks, Jews, or Arabs. The answer may be that Pashtuns have been slightly modified over time by various invaders and mixes as mentioned above. Yet they have kept their eastern Iranian base genetically overall.

 

There would thus also be Japhethitic R1a and R1b and Hamitic C YDNA present.

 

Many conclusions concerning the Semites come from the premise that the Semitic Haplogroups are all J as found among the three populations mentioned.

 

The Pashtun are classified as Iranian, which as we have seen is primarily Haplogroup I which is derived from the Semitic IJ Haplogroup (see below) but they vary as a typical Central Asian composite YDNA grouping. An attempt was made to classify the Pashtun in the 16th century as one of the Bani Israel, of the Lost Ten Tribes and as Joseph. This was debunked based on their Indo-Iranian affinities and language. However, it is an historical fact that the area of Khandahar, Kabul and Bactria also, on the other side of the Hindu Cush, were made provinces or satrapies of the Persian Empire and their languages are thus affected by that fact.  The DNA similarities with Elam and their reported historical descent and affinity with Joktan indicate that the original DNA of the Semites, including the Joktan Hebrews, was not J but F and the primary Semitic derivative is I and the secondary derivatives are J, both derived from IJ (based on S2 and S22) and then H and G. All the Eastern Semites of Elam and Joktan were Hg. I, rather than J. Thus these mutations occurred over the second millennium BCE and the extended mathematical models of the evolutionists are wrong.

 

The Durrany and Galzay tribes are held to be direct descendants of the Ibrani or Hebrews and probably of the sons of Joktan. Some also hold the Rabbani, Shinwari, Levani, Deftali, and Jaji from Afghanistan, and the Efridi and Yusufzai from Pakistan to also be Hebrew tribes.

 

Lud

 

Lud is a source of uncertainty and there are two explanations for the identification of, and locations of the sons of Lud. We will return to this puzzle shortly.

 

Other Locations of the Hebrews

 

The origin and location of the Hebrews is identified with Abraham as coming out of Ur of Chaldea and the sons of Arphaxad are identified with the Akkadian groups in the Mesopotamian plain between the children of Asshur, or the Assyrians, and the sons of Elam, who were on the east of the Tigris basin to the Persian plateau.

 

The other group of the Medes, who were associated with the Persians and occupied the high country to the north of Elam and Gutea, are not basically Semite, but we will see they do contain Semites now from their exposure to the Arabs and perhaps earlier. The Kurds predominantly derived from the Medes, the sons of Madai, a Japhethite. We will return to them later. The Guteans or Guti may well also be associated with the Goths as part of the later Parthian or Scythian Horde. We will examine their movements in a later paper.

 

Professor Cyrus Gordon also holds the early Minoans to be Semites and their language Linear A as being Semitic. His work on Linear A has been met with controversy.

 

The sons of Arphaxad are: Salah and Eber (from where the name Hebrew is derived). His sons Peleg and Joktan saw the split in the Hebrews. The sons of Joktan were thirteen in number and occupied the entire eastern area of the Arabian peninsular (Gen. 10:21-32) but many went on into Afghanistan or Pakistan, as we see above. The sons of Abraham through Hagar and some of the sons of Keturah, such as Midian, later joined them. The line of Abraham through Peleg was to Reu, Serug, Nahor, Terah to Abraham, Nahor and Haran. Abraham was called out of Ur of Chaldee and sent into the land of Canaan.

 

It follows that the lineages of the Semitic countries will give us clues as to the distribution of Semitic Haplogroups and mutations. The original position was to say simply that Haplogroup J is the Semitic Haplogroup and all others are not Semitic, but that cannot be true given the distribution and mixtures of the nation groups; and we now know that to be false in regard to the IJ proto Haplogoup. From the historical reconstruction, a number of other groups are also Semitic, as we will see.

 

For example, in the genetic structure of the Persians or Elamites, Hg I is predominant. It exceeds J by some 10%, and has an element of F and G with it. Those groups constitute half the YDNA of the Persians. The Middle Eastern Arabs also have a significant amount of I and some G. Haplogroups G, I and J constitute half of the Georgians/Armenians and the Turks and F, G, I and J are half the Italians with I and J comprising half the YDNA of the Greeks. When we go into Europe the balance of I increases dramatically.

 

G, (M201), H (M69), I (M170, M258, and P19) and J (12f2.1) appear to be known Semitic lineages with K (M9), the root base for all the sons of Japheth. Hg. J decreases as it moves west in Europe, but Hg. I remains more or less highly significant as far west as the Anglo-Saxons and then decreases among the Basque, Welsh, Irish and Scots, but is nevertheless still found in quantities of up to 15% among these known Celts.

 

The Anglo-Saxons came in from the Middle East as part of the horde at the fall of the Parthian Empire from what is now the area of Iraq and the area north of it. That occurred at the end of the second century CE. They moved into the area of NW Europe and the horde split up in various waves. The Anglo-Saxons and Jutes and the associated tribes of Lombards, Danes, Norwegians, Saxons and Fris, split up but retained a similar diversity. The northern French are also from the Middle East. The Normans constitute one element and are predominantly R1b but they contain other DNA groups such as I. The others are Francs in two groups. These are the Riphathian Francs and the Salien Francs. The Salien Francs could inherit through the male line only but the Riphathian Francs could inherit through both.

 

As we know, Riphath was a son of Japheth and we know that the nobility of these people also claimed descent from Antenor I, King of the Cimmerians, and also from the Trojans. They were understood to be the offspring of the group that remained in the Middle East with the sons of Hector. They named their major city after Paris and Troyes. Many of these people settled across the Channel in Britain and those tribes (e.g. Parisii) were also R1b Celts. Over 35% of the northern French are Haplogroups I and J. Approximately 35% of the Anglo-Saxons are Middle East Hg. I with some small amount of J. Approximately 40% of English are Middle Eastern and seemingly Semites of I mutated from the IJ group. The majority of all NW Celts and Anglo-Saxons are R1b and part of the same genetic divisions as the known Japhethite tribes. The obvious exception is to the east where the Slavs are R1a, and the largest R1a divisions among the horde coming into the North West was among the Norwegians, at about 30%.

 

Arabs

 

From the Bible, Torah and Qur’an, we learn that the Arabs are descendants of Shem, son of Noah. Some Arabs claim to trace their ancestry directly back to Noah and Adam.

 

Arab origin is divided into two major groups:

al-‘Āriba meaning, "Pure origin" and al-Musta’ribah  meaning, "Arabised Arabs".

 

The Pure Arabs are considered to be descendants of Noah through his son Shem, through his sons Aram and Arphaxad, and are known as Qahtanite. The Qahtanite are considered to have originated from the South Arabians, according to Arab genealogies.

 

The term Arabised-Arabs can be used for three different groups:

1)      For Arabs considered to be descendants of Abraham through Ishmael, through his son Adnan and known as Adanites.

2)      For Arabs who spoke other Afro-Asiatic languages. As Arabic speakers they are regarded as Arabs in contemporary times.

3)      For the "Mixed Arabs", between "Pure Arabs" and the Arabs from South Arabia.

 

The break-up of these groups will be discussed in the papers on Ishmael and Keturah.

Religions

 

While most Arabs are Muslim, a minority are Christians, and some are Jews. Muslims comprise Sunni, Shi’ite, Ibadhite, Alawite, Ismaili or Druze.

 

Before the introduction of Islam, most Arabs worshipped a number of deities while some converted to Christianity or Judiasm. The pagan deities were those such as Hubal, Wadd, Al-Lat, Manat and Uzza. A few hanifs favoured a vague form of monotheism. However, as Islam expanded more and more Arabs became Muslims and the old traditions disappeared.

 

Arab Christians generally follow one of the four main churches: Coptic, Maronite, Greek Orthodox, or Greek Catholic.

 

Gypsies or Roma

 

When the British explorer Richard Burton travelled throughout the Land of Midian in the late 19th century, he came upon a people known as the Hutaym (meaning broken). Although Muslims, they were a tribe of pariahs also found in Egypt.

           

    The Arabs of Midian always compare the Hutaym with the Ghagar (Ghajar) or Gypsies of Egypt; and this is the point which gives the outcasts a passing interest. I have not yet had an opportunity of carefully studying the race; nor can I say whether it shows any traces of skill in metal-working. Meanwhile, we must inquire whether these Helots [slaves], now so dispersed, are not old immigrants of Indian descent, who have lost their Aryan language, like the Egyptian Ghajar. In that case they would represent the descendants of the wandering tribes who worked the most ancient ateliers [workshops]. Perhaps they may prove to be congeners of the men of the Bronze Age, and of the earliest waves of Gypsy-immigration into Europe. (Burton, Midian (Revisited), p. 119; emphasis added)

 

Burton goes on to say:

    And I would here lay special stress upon my suspicion that the ancestors of the despised Hutaym may have been the Gypsy-caste that worked the metals in Midian. (ibid., p. 135).

 

The Hutayim he saw may have been simply the remnant of the true sons of Midian whose brother tribes had long since migrated into other areas of the Middle East and eventually into Europe, some perhaps via India.

 

In his book Travels in Arabia (1845 and 1848) (reprinted by The Oleander Press, Cambridge, UK, 1979), G.A. Wallin had this to say of the tribe known as the Hutaym:

    They are despised and illtreated by their Bedawy neighbours, to whom they are forced to pay a heavy brother-tax (khawe) without being thereby freed from other contributions of every kind. I have often seen how haughty Bedawies have driven their horses and camels through yet unmown fields, permitting the animals to feed on the corn without any check … they [the Hutaym] silently submit to their tyranny.

    When in their tents they are usually seen doing some handiwork, as repairing their weapons or making utensils and furniture … They also showed a stronger religious feeling … in their features also a different origin is to be traced, and their type is most evidently Syrian, but often with a very prominent Jewish cast. I regard them as a scanty remainder of some of the old Jewish or Nabataean aborigines of the land, … (p. 133)

 

Wallin’s comment about the Bedawi (Bedouin) manner of driving livestock into their neighbours’ crops is reminiscent of the Midianites doing the same to the Israelites when they were given mastery over Israel (Jdg. 6:3-6).

 

Burton’s use of the term Gypsy on several occasions may be the key to the identity of a relatively small group of the present-day descendants of Midian. In fact, there may be a strong case for including these people with the other known sons of Keturah.

 

The Wikipedia article (abridged) on the Gypsies or Roma contains a number of interesting facts.

 

The Roma (singular Rom; sometimes Rroma, Rrom) or Romanies, sometimes called "Romany folk" in the United Kingdom, often referred to as gypsies or gipsies, are a diverse ethnic group who live primarily in Southern and Eastern Europe, Western Asia, Latin America, the United States and the Middle East. They are believed to have originated in the Punjab and Rajasthan regions of the Indian subcontinent. They began their migration to Europe and North Africa via the Iranian plateau around 1050. Most Roma speak one of several dialects of Romani, an Indo-Aryan language.

 

Most Roma refer to themselves as Rom. The word means "husband", while Romni means "wife". … The origin of the word Rom … is proposed as the Sanskrit word ram … or rama … meaning "husband".

 

Worldwide, there are an estimated 8 to 10 million Roma. The largest population of Roma is found on the Balkan peninsular; however, significant numbers also live in the Americas, the former Soviet Union, Western Europe, the Middle East, and North Africa. The Roma recognize divisions among themselves based in part on territorial, cultural and dialectal differences. Some authorities recognize five main groups:

Kalderash are the most numerous, traditionally coppersmiths, from the Balkans, many of whom migrated to central Europe and North America;

Gitanos (also called Calé) mostly in the Iberian Peninsula, North Africa, and southern France; associated with entertainment;

Sinti mostly in Alsace and other regions of France and Germany; often travelling showmen and circus people (Other experts, and Sinti themselves, insist that Sinti are not a subgroup of Roma but rather a separate ethnic group which also had Indian origins and a history of nomadism);

Romnichal (Rom'nies) mainly in Britain and North America; and

Erlides (also known as Yerlii or Arli) settled in South-eastern Europe and Turkey.

 

Contemporary scholars have suggested that one of the first written references to the Roma, under the term "Atsinganoi", (Greek), dates from the Byzantine era during a time of famine in the 9th century. In the year 800 A.D., Saint Athanasia gave food to "foreigners called the Atsinganoi" near Thrace. Later, in 803 A.D., Theophanes the Confessor wrote that Emperor Nikephoros I had the help of the "Atsinganoi" to put down a riot with their "knowledge of magic".

 

"Atsingani" was used to refer to itinerant fortune tellers, ventriloquists and wizards who visited the Emperor Constantine IX in the year 1054. … In 1322 a Franciscan monk named Simon Simeonis described people resembling these "atsinganoi" living in Crete and in 1350 Ludolphus of Sudheim mentioned a similar people with a unique language whom he called Mandapolos, a word which some theorize was possibly derived from the Greek word mantes (meaning prophet or fortune teller).

 

Around 1360, an independent Romani fiefdom (called the Feudum Acinganorum) was established in Corfu and became "a settled community and an important and established part of the economy."[32] … By the 14th century, the Roma had reached the Balkans; by 1424, Germany; and by the 16th century, Scotland and Sweden. Some Roma migrated from Persia through North Africa, reaching Europe via Spain in the 15th century. The two currents met in France. …

 

Roma were enslaved for five centuries in Romania until abolition in 1864. Elsewhere in Europe, they were subject to ethnic cleansing, abduction of their children, and forced labor. During World War II, the Nazis murdered 200,000 to 800,000 Roma in an attempted genocide known as the Porajmos. Like the Jews, they were marked for extermination and sentenced to forced labour and imprisonment in concentration camps.

 

Genetic data strongly supports linguistic evidence that the Roma originated on the Indian subcontinent. Studies of Bulgarian, Baltic and Vlax Roma genetics suggest that about 50% of observed haplotypes belong to Y-chromosomal haplogroup H. Similar studies of the same population with mitochondrial DNA show 50% belong to female mitochondrial haplogroup M. Both of these are widespread across South Asia.

 

Hg. H is a derivative of F, which is the primary mutation for all Semites and Japhethites. 36% of Roma are either Hg.  I or J2 Semites. H is logged as an earlier division of F.

 

This genetic evidence indicates that approximately half of the gene pool of these studied Roma is similar to that of the surrounding European populations. Specifically, common Y-chromosome (i.e. male-line) haplogroups are haplogroups H (50%), I (22%) and J2 (14%), and R1b (7%). Common mitochondrial (i.e. female-line) haplogroups are H (35%), M (26%), U3 (10%), X (7%), other (20%). Whereas male haplogroup H and female M are rare in non-Roma European populations, the rest are found throughout Europe. However, female haplogroups U2i and U7 are almost absent from female Roma, but are present in South Asia (11%-35% approx).

 

By contrast, male Sinti Roma in Central Asia have H (20%), J2 (20%) and a high frequency of R2 (50%) which is found frequently in West Bengal and among the Sinhalese of Sri Lanka. The M217 marker, which accounts for about 1.6% of male Roma, is also found in West Bengal (Kivisild (2003) et al). Haplogroup L is found in about 10% of Indian males but is absent from Roma (though Gresham et al. does not seem to test for it), and also from West Bengal and Central Asian Sinti (Kivisild (2003) et al). However, a search of the Yhrd database shows that some Roma populations in Europe have considerable percentages of male haplogroup R1a1. Yhrd gives few matches with South Asian populations, but a large number of matches on haplogroup H with British Asian Londoners, a population that has a large proportion of Bengali and Sri Lankan groups.

 

A study published in Nature associates the Roma with the Sinhala, and must be viewed from this genetic profile of Romas. Sinhalese are mostly descendants of East and South Indian communities. “

 

This data and the information above would indicate that Sinhalese Sri Lankans may well be Semites from the same early base as the Rom and may be the Ophir group of the sons of Shem with the Rom being another of the brothers of Ophir of the Joktan Hebrews with some Bengalis also related.

 

All these genetic studies indicate a South-East Indian origin of the male Roma population. Haplogroup R1a1 occurs around 35-45% in the northwest of the Indian subcontinent, but only 10-15% in the southeast. On the other hand, Y-haplogroups H, R2 and J2 increase in frequency towards the southeast. R2 occurs around 20-40% in West Bengal and Andhra Pradesh (Bamshad et al. 2001, Kivisild et al. 2003, Sengupta et al. 2006, Sahoo et al. 2006). H and J2 occur 20-30% in South and East India.

 

Luba Kalaydjieva's research has shown that the original group appeared in India some 32-40 generations ago and was small, likely under 1,000 people.

(Ref: Origins and Divergence of the Roma (Gypsies), David Gresham, Bharti Morar, Peter A. Underhill, et al, Am J Hum (2001); The Eurasian Heartland: A continental perspective on Y-chromosome diversity, Wells et al.)  (Retrieved from http://en.wikipedia.org/wiki/Roma_people)

 

The R2 is a Japhethite group that is Aryan and related to the Celts and Slavs. Both these groups are descended from the R basic Haplogroup, which is found amongst the Dravidians and a large proportion of the Australian Aboriginals. The later waves of the Australian Aboriginals were thus Aryans related to the Dravidians, who intermingled with the C basic earlier inhabitants of Australia and perhaps even as late as the first millennium BCE from the Indianisation of South East Asia. The Aryan invasion of India took place 1000 BCE and the R basic subdivision is a later mutation of the YDNA system derived from P. found in Cameroon (Africa), Australia and India, as well as being very thinly spread through the Middle East. Thus a significant percentage of Aborigines are proto-Celt/Slavs or Aryans of the sons of Japheth. We will look more at the timings below.

 

The Concise Oxford Dictionary, under the entry gypsy, also says that the Roma were “of Hindu origin with dark skin and hair, and speaking a language (Romany) related to Hindi”. It gives the origin of the term as: “earlier gipcyan, gipsen from Egyptian, from the supposed origin of gypsies when they appeared in England in the early 16th c.”

 

Gypsy YDNA may look like this:

H   M69
•       H*   -
•       H1   M52
•      •       H1*   -
•      •       H1a   M82
•      •       •       H1a*   -
•      •       •       H1a1   M36, M197
•      •       •       H1a2   M97
•      •       •       H1a3   M39, M138
•      •       H1b   M370
•       H2   Apt

Y-DNA Haplogroup H: The founding mutation for Haplogroup H, M69, occurred in a Haplogroup F man, probably in the Indian subcontinent. Of course evolutionists assert that the founder of Haplogroup H probably lived about 30,000-40,000 years ago. This Haplogroup has not yet been studied in a comprehensive manner. Today, nearly all members of Haplogroup H live in the Indian subcontinent area. The Roma (also known as Gypsy) people, who apparently originated in India, are the main source of Haplogroup H in Western Europe.

 

Thus the YDNA Haplogoup H was developed from F on the Indian subcontinent (as was L) and the predominant source of H in Europe is from the Gypsies and subsequent Indian immigrants.  Haplogroups G, H, I, and J are assumed to be of Semitic origin and G, H, I are found in Assyrians with I and J being found in the Assyrians, Arphaxadites or Hebrews, Keturah Arab and Ishmaelite Arab and Jewish populations respectively. I and J are now known derivations from the one IJ group. Whilst we can demonstrate reasonably well that Gypsies are of Semitic origin that came in via India we cannot demonstrate their origin in the sons of Keturah. The language of the Romani was seemingly developed in Europe after they left India. The subgroup of the Vlax Rom are probably derived from an ancestor no more than 400-500 years ago in Europe.

 

Haplogroup F

The F Haplogroup stems from the division between the Yap M145, M203 divide for D and E and the RPS4Y 711 M216 divide for the C group. It is a small group and sometimes acts as a catchall because researchers did not do enough testing to determine the group correctly. There are small F groups in Georgia/Armenia, Persia, Uzbekistan, among the Kazan Tartar and in Khazakstan. The conclusion is that the basic root of F is nearly gone but the prolific sons survived and flourished, producing the major national groups and the mutations that flowed from that stem.

 

This stem determines all the other Haplogroups from F to R.

 

The basic F is P14, M89, M213.

 

In biblical terms, both Shem and Japheth passed this core Haplogroup on to all their offspring. Perhaps Ham also passed it to one of his sons. The charts would make Ham’s sons widely divergent.

The YDNA groups

 

All other YDNA groups from G to R2 are derived from one central Haplogroup F. This F group is central to known lineages of both Shem and Japheth. We will start with Lineage F, which is P14, M89, M213. This line is the basic line for G, H, I, J, and K.

 

We know that the lineages in known Semitic nations are G, I and J. There are also some lineages of E3b African or Hamitic lineages, together with some R1a and R1b. These lineages with G also spread to Turkey, Georgia/Armenia and Italy.

 

Conventional wisdom identifies the Middle Eastern Arabs as Haplogroup J and the Jewish Aaronic priesthood, which has an identified clear lineage to Shem, is at J2. This Haplogroup division identifies also the Buba Clan of the Lemba Tribe of Zimbabwe as Aaronic priests and they have been separated from the rest of Judah/Levi for perhaps 1900-2,500 years. Thus the J2 division is at least as old as that separation.

 

P29 Haplogroups K, L, M, N, O, P, Q and R appear to be Japhethite tribes. God said that He would bless Japheth, who was told that God would enlarge him and he would dwell in the tents of Shem. Thus we would expect to find a mixture of Japheth and Shem in the same national groupings. Thus Hgs. I and R1b and R1a groupings satisfy these criteria.

 

The argument might be raised that the Haplogroups of Shem and Japheth are both F and that all their sons are simple variations from them without distinction; and thus G to J are of both groups with K forming the next division and one that does not appear in the known Semitic J. Thus K must include all Japheth, but it might be then argued that G to I are open to both. Those arguments do not appear to stand up to scrutiny on a simple population basis.

 

The blessing of Japheth places Japheth within the tents of Shem, and thus prophecy is fulfilled. The blessings of Shem accrue to Japheth even though Japheth is larger in percentage terms in each nation.

 

What is certain is that the sheer extent of the Haplogroups I and R1b and also R1a in Europe makes it virtually impossible for every person in Europe not to be a descendant of Abraham, Isaac and Jacob, either through their maternal or paternal lines. Thus the Hittite and Parthian alliance with Israel has made them one people spread over a vast area with various language entities. Abraham has indeed become the father of many nations.

The mtDNA puzzle

 

As we noted in the paper Genetic Origin of the Nations (No. 265), there “are 26 mtDNA Haplogroups indicating 26 female mtDNA lines. Some seven original Hgs. or female “eves” are posed for Europe. However, when we examine the tree of mtDNA we find some interesting group derivatives. The so-called Supergroups are really only in three basic groups. In other words, they came from three main female lines. That is what we would expect to find if we assume there were only three females that bred on from the Ark, namely the wives of Shem, Ham and Japheth. These Haplogroups are all descended from a single female Supergroup, namely Haplogroup L. So in reality, all females are descended from one female line Hg. L. That is super L. This line then split into L1, and then L2 and L3. The line L3 diverged and from L3 came the other mtDNA mutations. Thus, all females came from one Eve whose mtDNA line was L.

 

The L groups L1, L2 and L3 are all found in Africa and are the major groups almost exclusively in sub-Saharan Africa. Only from Ethiopia north do we get large diversity of the mtDNA record. That is the basic reason why evolutionists claim that we all came out of Africa. The placement of the DNA groups can be seen in the work of J. D. McDonald who has grouped them by charts of Y and mtDNA Haplogroups available at

http://www.scs.uiuc.edu/~mcdonald/WorldHaplogroupsMaps.pdf.

 

The Supergroups M and N were next to diverge or mutate. From a biblical point of view we can argue easily that L was formed with Eve and the other groups were pre-Flood divisions that came on to the Ark. Thus, we could correctly argue that L, M, and N came on to the Ark within the accepted biblical account. It is also possible that the subdivision Supergroup R may have come on the Ark, depending on the number of females. All mtDNA Haplogroups are subdivisions of L, then M and N and subsequently R, which itself is a mutation of Hg. N. Thus the only argument between the Bible account and modern scientific DNA is the supposition that the mathematical models require a much longer period to mutate than the Bible chronology. That assumption is based on the premise that mtDNA does not force mutation of the Human Genome and that assumption is now being shown to be false.

 

Thus, from the original Hg. L we get Hg. M and Hg. N. Both of these groups are independent direct mutations of Hg. L.

 

So we can assume that Eve produced the line L and the three wives of Shem, Ham and Japheth are at least the three groups L, M and N. There may have been further divisions, given the fact that Noah may have had daughters not mentioned, and their mtDNA line may have been L, or M or N. It may have even been R, if we assume that the entire L line came in through the wife of Ham, as the L line is almost confined to the sub-Saharan tribes. We also have to address the fact that Eve was dark- skinned and the fact that Adam means “the one who was red”.

 

The wives of Shem and Japheth were of the subdivisions of L, perhaps M and N or perhaps also R.

 

The two groups M and N formed the following subgroups:

M produced three subdivisions:

M subgroup including;

C and Z, which split from each other, and D and G;

E subdivision; and

Q subdivision

 

We might thus also deduce that the wives of the sons of Noah were taken from the one family lineage maintaining purity in the generations in the female line also. The L2 and L3 split may have come from the family structure before the Flood. The daughters of Noah and the wives of the sons could have carried all three of the L subdivisions and the basic core subgroups of M, N and perhaps R. All subsequent groups from R are subgroups of R.

 

It is therefore possible that the women of the Ark, even if there were only the daughter of Noah and the wives of Shem, Ham and Japheth, could easily have contained the basis for the modern mtDNA diversity. We would not be surprised to find such diversity in a family of married sons even today. In Palestine, Egypt and South Pakistan it is common today to find these groups.”

 

We will deal with the female mtDNA diversity of the known Semitic nations in a later paper. They involve cross-breeding among nations, and we can identify these lines elsewhere.

 

In the paper Genetic Origin of the Nations (No. 265) we concluded that “there is thus nothing in the mtDNA variations and Haplogroups to preclude the Bible story and the Genesis account being accommodated by, or accommodating, the scientific advances we find here.

 

mtDNA Haplogroups L, M, N and perhaps R were present in the women on the Ark. The mutations occurred as each group moved out from the Middle East and crossbred with moving tribes and families over time.”

 

Semitic Haplogroup J

 

The Wikipedia article on the Semitic Haplogroup J identified the Haplogroup as coming originally from the combined Haplogroup IJ. The IJ group is defined by S2 and S22 in the YDNA chain.

 

The significance is that science is now beginning to hold and accept that I and J were once the same group and that all I Hg. people came from the same ancestry as the Jews and Arabs that possess the J system. Thus we have a clear acceptance in biblical terms that the Bible record that Hebrew peoples came from the one ancestor, Arphaxad, is correct.

 

What we do not fully know is if the IJ group developed in any of the other sons of Shem.

 

Haplogroup J was previously known as HG9 or Eu9/Eu10. It is defined by the 12f2.1 genetic marker, or the equivalent M304 marker.

 

Whilst science holds these evolutionary extended time-frames it still agrees that they arose in the Near East. Haplogroup IJ is in turn derived from Haplogroup F. This Haplogroup is the key Haplogroup for all Semitic and Japethite people.

 

The main current subgroups of J are J1 and J2, and between them account for almost all of the population of the Haplogroup. The Bible time-frame allows for an origin no earlier than 2200 BCE. The Cohen Modal Haplotype (CMH) for the sons of Aaron falls in  J1 and in J2.

 

The bulk of CMH is observed in J1 (53.0%) and J2 (43.2%) with a small portion falling outside Haplogroup J (3.8%). Thus the J1 J2 and other divisions must have occurred after the split of the Aaronic priesthood in 722 BCE or it is an independent mutation that does not solely identify the entire priesthood. 

 

Wikipedia holds that “although you can have the CMH in either J1 or J2, it is the genetic signature in J1 that is considered the Jewish priestly signature.”

 

Haplogroup J2 is defined by the M172 marker, and Haplogroup J1, defined by the M267 marker.

 

The Wikipedia article on: Haplogroup J1 (Y-DNA) says:

Haplogroup J1 is notable since this haplogroup shows highest frequencies in the Middle East North Africa and Ethiopia [Thomas et al study 1999] J1 was spread by two temporally distinct migratory episodes, the most recent one probably associated with the diffusion of Arab people Haplogroup J1 is most frequent in Palestinian Arabs (38.4%) [Semino et al] and Arab Bedouins (62% and 82% in Negev desert Bedouins). Also in Arabic speaking countries like: Algeria (35%), Syria (30%), the southern Levant Iraq (33%), the Sinai Peninsula, and the Arabian Peninsula collapsing suddenly at the borders of Arabic countries with non Arabic countries (Turkey and Iran). It entered Ethiopia in the Neolithic with the Neolithic Revolution and spread of agriculture, where it is found mainly among Semitic speakers (e.g. Amhara 33.3%, but Oromo 3.8%). It spread later to North Africa in historic times (as identified by the motif YCAIIa22-YCAIIb22; Algerians 35.0%, Tunisians 30.1%), where it became something like a marker of the Arab expansion in the early medieval period (Semino et al. 2004). Researchers believe that marker DYS388=17 (Y DNA tests for STR - Short Tandem Repeater) is linked with the later expansion of Arabian tribes in the southern Levant and northern Africa (Di Giacomo et al. 2004). Haplogroup J1 is found almost exclusively among modern populations of Southwest Asia, North Africa, and East Africa, essentially delineating the region popularly known as the Middle East and associated with speakers of Semitic languages .The distribution of J1 outside of the Middle East is associated [with] Arabs and Phoenecians through trade and conquest like Sicily south Italy, Spain, Azerbaijan, Turkey, Pakistan, and with Jews who have historical origins in the Middle East and speak (or historically spoke) a Semitic language, though typically Haplogroup J2 is more than twice as common among Jews. In Jewish populations overall, J1 constitutes 14.6% of the Ashkenazim results and 11.9% of the Sephardic results (Semino et al. 2004).

 

Wikipedia says regarding Haplogroup J2 (Y-DNA)

Haplogroup J2 is present mostly in Europe, but is found especially in the northern Levant (Kurdistan, Armenia), Anatolia: Muslim Kurds (28.4%), Central Turks (27.9%), Georgians (26.7%), Iraqis (25.2%), Lebanese (25%), Ashkenazi Jews (23.2%) and Sephardim Jews (28.6%) J2 is not found in Semitic languages speaking populations of Africa (like Amhari and Tigrinia in Ethiopia) (Semino et al. 2004). However, J2 was found to encompass several unrelaterd sub-Haplogroups (22 subs with 12 subs that have high frequencies) that originated in different regions: Italians, Balkan, Aegean, Balkan, Anatolian (Kurds and Turkey), Caucasian (Georgia.) and finally Somalian (see ref: Semino et al. 2004). It was thought of as the genetic markers of Anatolian Neolithic agriculturalists. It is also very frequent in the Balkans (Greeks 20.6%, Albanians 19.6%) and in southern Italy (16.7-29.1%). Its frequency rapidly drops in the Carpathian basin (Croatians 6.2%, Hungarians 2.0%, Ukrainians 7.3%). The significant presence of J2 (J2b2+J2a) in India (18.6% in Dravidian upper castes, 14% in Aryan upper castes, 2% in tribes; Sengupta et al. 2006) must be of a very early date, because “Indian J2 is not accompanied by its ‘loyal fellow-traveller’ E3b1 that penetrated to the Near East from North Africa after the end of the Ice Age and is tightly bound with the spread of both J-subbranches since the Neolithic era.”

(cf. Wikipedia article Haplogroup J)

 

The significance of the Cohen Modal Haplotype in both J1 and J2 indicates that the division and development of these Haplogroups are a  result of mutation after the spread of the Aaronic priesthood which occurred no earlier than 1458 BCE and perhaps later than 722 BCE. A large portioin of this appears to be among Arabs also.

 

The Haplotype thus mutates faster than thought and the models are wrong.

 

The presence of J2 in India without the E3b1 traveller indicates that the J2 Haplotype developed in India from Hebrews, who had not interbred with Canaanites or Egyptians in either the Mixed Multitude or the occupation of Canaan. Thus the migration of these people must have occurred with the early Hebrews (perhaps Joktan, or even earlier) that moved from Assyria probably with the Assyrians and Cushites and some Japhethites Hg. RxR1 to Harappa and Mohenjo Daro in the Indus perhaps even as early as the occupation in the 18th century BCE (cf. Mysticism Chapter 1 Spreading the Babylonian Mysteries (No. B7_1).

 

The Semites moved on into South India, Bengal and Sri Lanka. The Sinhalese of Sri Lanka also have R2 Japhethite lineages, which is the Indian mutation from RxR1. As we have seen, the Roma have similar mixes of Haplogroups.

 

The Cushites and Japhethites also went into South India and moved on into Southeast Asia.

 

The K populace mutated from F and a major section formed the Negritos and Melansesians.

 

The next division of F Japhethite subdivision and the RxR1 had split from them into P in the Middle East.

 

Hg. P mutated into the RxR1 Hg. from which all Celts and Slavs are descended.

 

RxR1 remained in India forming the  Dravidians and another base group moved with the majority C basic Hg. and formed the basis of the Australian Aboriginal population ca. 1700 BCE. They appear to have come in eight waves, perhaps not mixed originally. One community is apparently a late arrival Hg. O, probably from the Indo-Malays or Chinese.

 

The Cushites and other Hamitics also moved Northeast and formed the Mongols and the base population of what became the Maori and the C3 Amerindians. The Hamitic group also formed the mutation Hg. D from which many of the the Japanese and Tibetans are descended.

 

K at M9 also split into a single group M214 which formed the branch of the Japhethite sons of the Huns and Finns under the N Haplogroup, together with the Chinese and Malays and some Polynesians and Philippinos under the O haplogroup.

 

The basic Papua/New Guinea populations retained the original K as did some Phoenician traders at K2.

 

No Semites moved to Australasia.

 

Tasmania was inhabited originally by K Negritos as was New Zealand with the Maorii or Moriori after an earler settlement and ultimately they were forced out by the HG C Maori. 

 

Wikipedia specific information on Base J is:

 

J*(xJ1,J2)

There are also some Haplogroup J Y-chromosomes that belong to neither J1 nor J2, and are said to be in the Haplogoup or paragroup J*(xJ1,J2), however, they are extremely rare. This means that haplogroup J* includes all of J except for J1 and J2

 

Technical specification of mutation

The technical details of M304 are:

Nucleotide change: A to C

Position (base pair): 421

Total size (base pairs): 527

Forward 5′→ 3′: caaagtgctgggattacagg

Reverse 5′→ 3′: cttctagcttcatctgcattgt

 

Semitic Haplogoups and their subclades will be reproduced in another paper Appendix.

 

Tables of the lineages of the Sons of Shem will be reproduced in the paper Sons of Shem Part VII: Charts for P212A-212F (No. 212G).

 

 

 

q


 

 

 

 

 

 

 

 

 

 

 

 

 

 


 

 


Christian Churches of God

PO Box 369 Woden, ACT 2606 Australia

E-mail:   CCG Secretary


Copyright:   The papers on this site may be freely copied and distributed provided they are copied in total with no alterations or deletions. The publisher's name and address and the copyright notice must be included. No charge may be levied on recipients of distributed copies. Brief quotations may be embodied in critical articles and reviews without breaching copyright.


| Search | Alphabetic Index | Long Catalogue | Home Page | Webmaster | Additional |